Journal: Frontiers in Immunology

Article Title: Antigen Presenting Cells Contribute to Persistent Immune Activation Despite Antiretroviral Therapy Initiation During Hyperacute HIV-1 Infection

doi: 10.3389/fimmu.2021.738743

Figure Lengend Snippet: pDC cytokine production in response to TLR antigen stimulation. HIV negative individuals and hyperacute and chronic ART groups at month 1, 12 and 24 post-infection were assessed for pDC TNF-α production following stimulation of (A) TLR4, (B) TLR7/8 or (C) TLR9 and IFN-α production following stimulation of (D) TLR4, (E) TLR7/8 or (F) TLR9.

Article Snippet: Toll-like receptor (TLR) agonists for cell stimulation were as follows: TLR4 ligand lipopolysaccharide (LPS) was from Sigma-Aldrich (Saint Louis, MO, USA), TLR7/8 ligand imidazoquinoline compound (CL097) and TLR9 ligand class A CpG oligonucleotide (ODN 2216) were from InvivoGen (San Diego, CA, USA).

Techniques: Infection

Journal: Cell Reports

Article Title: Dendritic cell phagosomes recruit GRASP55 for export of antigen-loaded MHC molecules

doi: 10.1016/j.celrep.2025.115333

Figure Lengend Snippet:

Article Snippet: Class B CpG ODN 1668 - Murine TLR9 ligand , InvivoGen , Cat# tlrl-1668.

Techniques: Transduction, Virus, Expressing, Recombinant, Purification, Protease Inhibitor, Software

Journal: Veterinary Research

Article Title: Comparison of innate immune agonists for induction of tracheal antimicrobial peptide gene expression in tracheal epithelial cells of cattle

doi: 10.1186/s13567-014-0105-8

Figure Lengend Snippet: Effects of CpG oligodinucleotide, interleukin-17A and interferon-α on tracheal antimicrobial peptide gene expression. Dose- and time-dependent effects were measured for CpG oligodinucleotide (A,B) , a TLR9 agonist; interleukin-17A (C,D) ; and interferon-α (E,F) . For the dose–response studies (A,C,E) , confluent bTEC were stimulated in triplicate with various concentrations of agonist for 16 h. For the time-course studies (B,D,F) , confluent bTEC were stimulated in triplicate for 4, 8, 16 or 24 h with the doses of agonist shown. Gene expression of TAP relative to that of GAPDH was measured using real-time RT-qPCR. Lipopolysaccharide (LPS, 0.1 μg/mL) was used in all assays as a positive control and standard. *, significantly different from unstimulated cells ( P < 0.05).

Article Snippet: The TLR agonists included lipoteichoic acid from S taphylococcus aureus (an agonist of TLR2/2 homodimer; Sigma-Aldrich, St. Louis, MO, USA, item number L2630), Pam3CSK4 (agonist of TLR2/1 heterodimer; Invivogen, San Diego, CA, item t1rl-pms), FSL-1 (agonist of TLR2/6 heterodimer; Invivogen, item t1r1-fsl), flagellin from Salmonella enteritica serovar Typhimurium (TLR5 agonist; Invivogen, San Diego, CA, item t1r1-pstfla), and class B CpG ODN 2007 (bovine/porcine-specific TLR9 agonist; Invivogen, item t1rl-2007) along with the negative control of non-CpG ODN 2007 (consisting of GpC motifs; Invivogen, item t1r1-2007c).

Techniques: Expressing, Quantitative RT-PCR, Positive Control

Journal: International Journal of Molecular Sciences

Article Title: Experimental Combined Immunotherapy of Tumours with Major Histocompatibility Complex Class I Downregulation

doi: 10.3390/ijms19113693

Figure Lengend Snippet: Comparison of the anti-tumor effects induced after the administration of CpG ODN1826 and α-GalCer either alone or in a mix in the non-immunized and immunized mice. Animals ( n = 5) were injected s.c. with TC-1/A9 cells and immunized 3 times by a gene gun with either the empty pBSC plasmid (referred to as non-immunized mice, A – C ) or pBSC/PADRE.E7GGG (immunized mice, D – F ). Vaccine adjuvants ODN1826 ( A , D ), α-GalCer ( B , E ), or a mix of ODN1826 and α-GalCer ( C , F ) were administered on the same days as DNA vaccines. Some groups received a monoclonal antibody against Tim-3. No. of mice with a tumor/no. of mice in the group is indicated. Bars: ±SEM; *** p < 0.001, **** p < 0.0001. Statistical significance refers to the comparison with the group immunized with the PADRE.E7GGG gene. The experiment was repeated with similar results.

Article Snippet: The TLR-9 agonists ODN1826 (class B; TCCATGACGTTCCTGACGTT) and ODN1585 (class A; GGGGTCAACGTTGAGGGGG) carrying immunostimulatory CpG motifs and a negative control, ODN1982 (TCCAGGACTTCTCTCAGGTT) without CpG motifs, were synthetized with a phosphorothioate-modified backbone (Generi Biotech, Hradec Kralove, Czech Republic) and dissolved in phosphate-buffered saline (PBS; ODN1826 and ODN1982) or deionized water (ODN1585). α-GalCer (Abcam, Cambridge, UK, ab144262) was solubilized in dimethyl sulfoxide (DMSO; Sigma-Aldrich, St. Louis, MO, USA) by heating at 80 °C for 20 min and sonication in an ultrasonic bath until complete dissolution.

Techniques: Comparison, Injection, Plasmid Preparation, Vaccines

Journal: International Journal of Molecular Sciences

Article Title: Experimental Combined Immunotherapy of Tumours with Major Histocompatibility Complex Class I Downregulation

doi: 10.3390/ijms19113693

Figure Lengend Snippet: The effects of different dosage and timing protocols. Mice ( n = 5) were injected with TC-1/A9 cells and immunized by a gene gun. Mice received combinations of ODN1826, α-GalCer and α-Tim-3 3 times on the days of immunization ( A ), 5 times with two additional doses on days 13 and 17 ( B ) and 3 times with a one-week delay following DNA immunization (i.e., on days 10, 13 and 17) ( C ). Bars: ±SEM; ** p < 0.01, *** p < 0.001, **** p < 0.0001. Statistical significance refers to the comparison with the group immunized with the PADRE.E7GGG gene. The experiment was repeated with similar results.

Article Snippet: The TLR-9 agonists ODN1826 (class B; TCCATGACGTTCCTGACGTT) and ODN1585 (class A; GGGGTCAACGTTGAGGGGG) carrying immunostimulatory CpG motifs and a negative control, ODN1982 (TCCAGGACTTCTCTCAGGTT) without CpG motifs, were synthetized with a phosphorothioate-modified backbone (Generi Biotech, Hradec Kralove, Czech Republic) and dissolved in phosphate-buffered saline (PBS; ODN1826 and ODN1982) or deionized water (ODN1585). α-GalCer (Abcam, Cambridge, UK, ab144262) was solubilized in dimethyl sulfoxide (DMSO; Sigma-Aldrich, St. Louis, MO, USA) by heating at 80 °C for 20 min and sonication in an ultrasonic bath until complete dissolution.

Techniques: Injection, Comparison

Journal: International Journal of Molecular Sciences

Article Title: Experimental Combined Immunotherapy of Tumours with Major Histocompatibility Complex Class I Downregulation

doi: 10.3390/ijms19113693

Figure Lengend Snippet: Tumor-infiltrating immune cells and their role in tumor growth. Analysis of tumor-infiltrating cells was performed by flow cytometry ( A , B ). Mice ( n = 4) were injected with tumor cells and immunized by a gene gun. Vaccine adjuvants and anti-Tim-3 were administered on the same days as the DNA vaccines. Tumor cells were isolated on day 12 from non-treated tumors and on days 14–18 from treated tumors and stained with fluorochrome-labeled antibodies. ( A ) Frequencies of CD45 + and CD3 + cells, Treg (CD4 + CD25 + Foxp3 + ) and Nrp1 + Treg cells. Statistical significance refers to the comparison with the non-treated (pBSC) group. ( B ) Overview of the mean percentages of the major subpopulations of tumor-infiltrating cells in total cells. ( C ) The effect of in vivo depletion of immune cells and neutralization of IFN-γ on the anti-tumor response induced by immunotherapies with ODN1826 or α-GalCer in the immunized mice ( n = 5). Vaccine adjuvants were injected on the days of immunization. Statistical significance refers to the comparison with the group that was immunized with the PADRE.E7GGG gene and received an adjuvant. Bars: ±SEM; * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.

Article Snippet: The TLR-9 agonists ODN1826 (class B; TCCATGACGTTCCTGACGTT) and ODN1585 (class A; GGGGTCAACGTTGAGGGGG) carrying immunostimulatory CpG motifs and a negative control, ODN1982 (TCCAGGACTTCTCTCAGGTT) without CpG motifs, were synthetized with a phosphorothioate-modified backbone (Generi Biotech, Hradec Kralove, Czech Republic) and dissolved in phosphate-buffered saline (PBS; ODN1826 and ODN1982) or deionized water (ODN1585). α-GalCer (Abcam, Cambridge, UK, ab144262) was solubilized in dimethyl sulfoxide (DMSO; Sigma-Aldrich, St. Louis, MO, USA) by heating at 80 °C for 20 min and sonication in an ultrasonic bath until complete dissolution.

Techniques: Flow Cytometry, Injection, Vaccines, Isolation, Staining, Labeling, Comparison, In Vivo, Neutralization, Adjuvant

Journal: International Journal of Molecular Sciences

Article Title: Experimental Combined Immunotherapy of Tumours with Major Histocompatibility Complex Class I Downregulation

doi: 10.3390/ijms19113693

Figure Lengend Snippet: Activation of CD8 + T cells by combined immunotherapy and characterization of tumor-infiltrating CD8 + T cells. ( A ) Analysis of activated CD8 + cells by an ELISPOT assay. Mice ( n = 3) were immunized by a gene gun on days 3, 6 and 10 and inoculated with ODN1826, α-GalCer and anti-Tim-3 on the days of immunization (D3) or with a one-week delay following DNA immunization (D10). Eight days after the last immunization, mononuclear cells were prepared from pooled splenocytes, restimulated with peptides and IFN-γ-producing-cells were detected. Columns, mean of triplicate samples; bars, ± SEM. The experiment was repeated with similar results. ( B ) Analysis of intratumoral CD8 + T cells by flow cytometry. The experiment was performed as in . Columns, mean of four samples; bars, ± SEM; * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.001. Statistical significance refers to the comparison with the non-treated (pBSC) group.

Article Snippet: The TLR-9 agonists ODN1826 (class B; TCCATGACGTTCCTGACGTT) and ODN1585 (class A; GGGGTCAACGTTGAGGGGG) carrying immunostimulatory CpG motifs and a negative control, ODN1982 (TCCAGGACTTCTCTCAGGTT) without CpG motifs, were synthetized with a phosphorothioate-modified backbone (Generi Biotech, Hradec Kralove, Czech Republic) and dissolved in phosphate-buffered saline (PBS; ODN1826 and ODN1982) or deionized water (ODN1585). α-GalCer (Abcam, Cambridge, UK, ab144262) was solubilized in dimethyl sulfoxide (DMSO; Sigma-Aldrich, St. Louis, MO, USA) by heating at 80 °C for 20 min and sonication in an ultrasonic bath until complete dissolution.

Techniques: Activation Assay, Enzyme-linked Immunospot, Flow Cytometry, Comparison